Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05846
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208883
Product ID ORK05846
Clone name fh25424
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol LNPEP
cDNA sequence DNA sequence (5824 bp)
Predicted protein sequence (627 aa)
Description Leucyl-cystinyl aminopeptidase (EC 3.4.11.3) (Cystinyl aminopeptidase) (Oxytocinase) (OTase) (Insulin-regulated membrane aminopeptidase) (Insulin-responsive aminopeptidase) (IRAP) (Placental leucine aminopeptidase) (P-LAP) [Contains: Leucyl-cystinyl amino
Features of the cloned cDNA sequence

Length: 5824 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3358 bp
Genome contig ID gi51511721f_96241192
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTGACAAAGCGAGACTGTCTCAAAAAACAAAAAAC
Flanking genome sequence
(152166 - 152215)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGAGTTAAGTGTTGATTTTGTTGGATTACTGACAGTTTGTT

Features of the protein sequence

Length: 627 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92120 0 100.0 leucyl/cystinyl...
Homo sapiens
CAB94753 0 99.6 oxytocinase/ins...
Homo sapiens
NP_787116 0 99.6 leucyl-cystinyl...
Homo sapiens
AAB66673 0 99.6 oxytocinase spl...
Homo sapiens
AAB66672 0 99.6 oxytocinase spl...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR014782 27 37 PR00756 Peptidase M1
IPR014782 63 78 PR00756 Peptidase M1
IPR014782 82 94 PR00756 Peptidase M1
HMMPfam IPR014782 1 154 PF01433 Peptidase M1
ScanRegExp IPR006025 63 72 PS00142 Peptidase M
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp