ORK05867

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05867

Order Kazusa clone(s) from :

Accession No	AB209529
Product ID	ORK05867
Clone name	fk10433
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PIDD1
cDNA sequence	DNA sequence (3917 bp) Predicted protein sequence (751 aa)
Description	Leucine-rich repeat and death domain-containing protein (p53-induced protein with a death domain).

Features of the cloned cDNA sequence

Description

Length: 3917 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	127 bp
Genome contig ID	gi51511727r_689180
PolyA signal sequence (None)	+--------+--------+----*----+---- TGTGAGCAACAAAACTGCACTGTTTCTTTCACCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAGCTTGATTTATTTGTTGGATGGAGAAGCCGTTGGAGGGCGGAGGGTG

Features of the protein sequence

Description

Length: 751 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92766	100.0	leucine rich re...	Homo sapiens
Q9HB75	99.5	Leucine-rich re...	Homo sapiens
AAG13461	99.4	PIDD [Homo sapi...	Homo sapiens
XP_508206	91.7	leucine rich re...	Pan troglodytes
AAP97716	99.6	unknown [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001611	82	103	PF00560	Leucine-rich repeat
	IPR001611	105	127	PF00560	Leucine-rich repeat
	IPR000488	630	714	PF00531	Death
HMMSmart	IPR003591	80	102	SM00369	Leucine-rich repeat
	IPR003591	103	126	SM00369	Leucine-rich repeat
	IPR000488	619	714	SM00005	Death
ProfileScan	IPR000906	156	263	PS51145	ZU5
	IPR000906	294	406	PS51145	ZU5
	IPR000488	629	714	PS50017	Death

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp