ORK05910

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05910

Order Kazusa clone(s) from :

Accession No	AB209921
Product ID	ORK05910
Clone name	ek00029
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	MAN2B1
cDNA sequence	DNA sequence (3131 bp) Predicted protein sequence (1007 aa)
HaloTag ORF Clone	FHC05910
Flexi ORF Clone	FXC05910
Description	Lysosomal alpha-mannosidase precursor (EC 3.2.1.24) (Mannosidase, alpha B) (Lysosomal acid alpha-mannosidase) (Laman) (Mannosidase alpha class 2B member 1) [Contains: Lysosomal alpha-mannosidase A peptide; Lysosomal alpha-mannosidase B peptide; Lysosomal

Features of the cloned cDNA sequence

Description

Length: 3131 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	107 bp
Genome contig ID	gi42406306r_12518327
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- GGGCTGCTGCCATTAAAACGCTACTACTAAGACTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGTCGCTCTGTGACTGAGTGTGGGTTTTTTTTGTCTGTTATTTGCTTGT

Features of the protein sequence

Description

Length: 1007 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD93158	100.0	mannosidase, al...	Homo sapiens
AAC51362	99.8	lysosomal alpha...	Homo sapiens
O00754	99.8	Lysosomal alpha...	Homo sapiens
BAF84261	99.7	unnamed protein...	Homo sapiens
AAC34130	99.7	lysosomal alpha...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000602	60	378	PF01074	Glycoside hydrolase
	IPR015341	382	461	PF09261	Glycoside hydrolase
	IPR011682	506	997	PF07748	Glycosyl hydrolases 38

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	26	PPLPPLCFFLLLLAAAGARAGGY	48	PRIMARY	23