ORK05923

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05923

Order Kazusa clone(s) from :

Accession No	AB209377
Product ID	ORK05923
Clone name	fh18469
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAP4
cDNA sequence	DNA sequence (5590 bp) Predicted protein sequence (1163 aa)
Description	Microtubule-associated protein 4 (MAP 4).

Features of the cloned cDNA sequence

Description

Length: 5590 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2096 bp
Genome contig ID	gi89161205r_47767190
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AAGAGTAAATAAATAAAGCTGCCTGATGTCCCATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACGCAGGCTTCGTGCTTCTGTCTCGTTTTGCATCTACCACCTCCCTGGAT

Features of the protein sequence

Description

Length: 1163 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92614	100.0	microtubule-ass...	Homo sapiens
NP_002366	99.9	microtubule-ass...	Homo sapiens
P27816	99.8	Microtubule-ass...	Homo sapiens
AAA59553	99.6	microtubule-ass...	Homo sapiens
A53253	92.8	microtubule-ass...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001084	951	981	PF00418	Tubulin-binding Tau protein
	IPR001084	1020	1050	PF00418	Tubulin-binding Tau protein
	IPR001084	1051	1081	PF00418	Tubulin-binding Tau protein
	IPR001084	1082	1113	PF00418	Tubulin-binding Tau protein
ScanRegExp	IPR001084	968	980	PS00229	Tubulin-binding Tau protein
	IPR001084	1037	1049	PS00229	Tubulin-binding Tau protein
	IPR001084	1068	1080	PS00229	Tubulin-binding Tau protein
	IPR001084	1100	1112	PS00229	Tubulin-binding Tau protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp