ORK05931

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05931

Order Kazusa clone(s) from :

Accession No	AK226139
Product ID	ORK05931
Clone name	pg00222
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAPT
cDNA sequence	DNA sequence (6773 bp) Predicted protein sequence (341 aa)
Description	Microtubule-associated protein tau (Neurofibrillary tangle protein) (Paired helical filament-tau) (PHF-tau).

Features of the cloned cDNA sequence

Description

Length: 6773 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	255 bp
Genome contig ID	gi51511734f_41305985
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TGGGCTAGTAATAAAATATTTAAAAAAAAACATTC
Flanking genome sequence (151654 - 151703)	----+--------+--------+--------+--------+----* AAAAACATGGCCACATCCAACATTTCCTCAGGCAATTCCTTTTGATTCTT

Features of the protein sequence

Description

Length: 341 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAA60615	1.7e-81	100.0	microtubule-ass...	Homo sapiens
AAP36583	1.7e-81	100.0	microtubule-ass...	synthetic construct
EAW93573	1.8e-81	100.0	microtubule-ass...	Homo sapiens
XP_860302	1.5e-76	94.8	similar to micr...	Canis lupus fam...
AAI26096	8.4e-76	92.9	Mapt protein [R...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002955	81	92	PR01261	Tau protein
	IPR002955	93	102	PR01261	Tau protein
	IPR002955	117	124	PR01261	Tau protein
	IPR002955	144	152	PR01261	Tau protein
	IPR002955	153	160	PR01261	Tau protein
	IPR002955	175	184	PR01261	Tau protein
HMMPfam	IPR001084	174	205	PF00418	Tubulin-binding Tau protein
	IPR001084	206	236	PF00418	Tubulin-binding Tau protein
	IPR001084	237	268	PF00418	Tubulin-binding Tau protein
ScanRegExp	IPR001084	192	204	PS00229	Tubulin-binding Tau protein
	IPR001084	223	235	PS00229	Tubulin-binding Tau protein
	IPR001084	255	267	PS00229	Tubulin-binding Tau protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp