Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06009
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209755
Product ID ORK06009
Clone name bh00154
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MLLT10
cDNA sequence DNA sequence (5203 bp)
Predicted protein sequence (508 aa)
Description Protein AF-10.
Features of the cloned cDNA sequence

Length: 5203 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3215 bp
Genome contig ID gi89161187f_21763580
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AAAATGTTTTGTTAATAAAATTTAATAATGTTTAT
Flanking genome sequence
(308985 - 309034)
----+----*----+----*----+----*----+----*----+----*
AACTCCGTGCCATTCTCATTTGGAGAGGATGGAGGGGGTGCACCCATGTT

Features of the protein sequence

Length: 508 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92992 7.6e-167 100.0 myeloid/lymphoi...
Homo sapiens
P55197 9.2e-165 100.0 Protein AF-10; ...
Homo sapiens
XP_544224 2.9e-160 97.0 similar to AF-1...
Canis lupus fam...
XP_001916073 8.1e-160 96.8 similar to Prot...
Equus caballus
NP_001009569 1.3e-159 100.0 protein AF-10 i...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR001965 60 119 SM00249 Zinc finger
ProfileScan IPR001965 58 121 PS50016 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp