ORK06065

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06065

Order Kazusa clone(s) from :

Accession No	AB208845
Product ID	ORK06065
Clone name	fh21177
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MUT
cDNA sequence	DNA sequence (5213 bp) Predicted protein sequence (197 aa)
Description	Methylmalonyl-CoA mutase, mitochondrial precursor (EC 5.4.99.2) (MCM) (Methylmalonyl-CoA isomerase).

Features of the cloned cDNA sequence

Description

Length: 5213 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	348 bp
Genome contig ID	gi89161210r_49407052
PolyA signal sequence (ATTAAA,-14)	+--------+--------+----*----+---- TGTTTACTTTTTATATTAAGAATTAAACTGTACCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAACTCTGACTATTCCCATTTGTCAGTTTAGCATTACATTGTCTTG

Features of the protein sequence

Description

Length: 197 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92082	2.7e-77	100.0	methylmalonyl C...	Homo sapiens
CAI14311	3.4e-75	100.0	methylmalonyl C...	Homo sapiens
AAH16282	3.9e-75	99.4	Methylmalonyl C...	Homo sapiens
XP_001104455	3.9e-75	99.4	methylmalonyl C...	Macaca mulatta
AAA59569	3.9e-75	99.4	methylmalonyl-C...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006158	62	182	PF02310	Cobalamin (vitamin B12)-binding
HMMTigr	IPR006159	60	191	TIGR00640	Methylmalonyl-CoA mutase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp