Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06066
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209229
Product ID ORK06066
Clone name fj13933
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MVD
cDNA sequence DNA sequence (4367 bp)
Predicted protein sequence (232 aa)
Description Diphosphomevalonate decarboxylase (EC 4.1.1.33) (Mevalonate pyrophosphate decarboxylase) (Mevalonate (diphospho)decarboxylase).
Features of the cloned cDNA sequence

Length: 4367 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1079 bp
Genome contig ID gi51511732r_87146278
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGGGCAGCTTGCTGTGGGGCAGTGCAGGGAGTCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCCCAGGTGTCAGGAGAGGTCCCCGCCGAGTGCTTCAGCTGCCC

Features of the protein sequence

Length: 232 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92466 1.4e-99 100.0 diphosphomevalo...
Homo sapiens
XP_001135959 2.4e-76 99.4 diphosphomevalo...
Pan troglodytes
XP_523460 2.5e-76 99.4 diphosphomevalo...
Pan troglodytes
P53602 1.6e-71 94.2 Diphosphomevalo...
Homo sapiens
AAP36301 1.6e-71 94.2 mevalonate (dip...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006204 126 181 PF00288 GHMP kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp