Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06124
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209107
Product ID ORK06124
Clone name hh06429
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NDST1
cDNA sequence DNA sequence (5937 bp)
Predicted protein sequence (698 aa)
Description Bifunctional heparan sulfate N-deacetylase/N-sulfotransferase 1 (EC 2.8.2.8) (Glucosaminyl N-deacetylase/N-sulfotransferase 1) (NDST- 1) ([Heparan sulfate]-glucosamine N-sulfotransferase 1) (HSNST 1) (N- heparan sulfate sulfotransferase 1) (N-HSST 1) [Inc
Features of the cloned cDNA sequence

Length: 5937 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3012 bp
Genome contig ID gi51511721f_149780621
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CGAACTAACTGCTAATAAAGTGGGGTTCTGTTTGT
Flanking genome sequence
(137346 - 137395)
----+----*----+----*----+----*----+----*----+----*
ACACCTTGGTCCTGTCTGACCTTTTTGCAAGGCCCGCAGGGAAGGGTGGA

Features of the protein sequence

Length: 698 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92344 0 100.0 N-deacetylase/N...
Homo sapiens
P52848 0 100.0 Bifunctional he...
Homo sapiens
XP_001108449 0 99.8 N-deacetylase/N...
Macaca mulatta
XP_001166515 0 99.7 N-deacetylase/N...
Pan troglodytes
AAA67765 0 99.7 heparan sulfate...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000863 420 683 PF00685 Sulphotransferase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp