ORK06124

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06124

Order Kazusa clone(s) from :

Accession No	AB209107
Product ID	ORK06124
Clone name	hh06429
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NDST1
cDNA sequence	DNA sequence (5937 bp) Predicted protein sequence (698 aa)
Description	Bifunctional heparan sulfate N-deacetylase/N-sulfotransferase 1 (EC 2.8.2.8) (Glucosaminyl N-deacetylase/N-sulfotransferase 1) (NDST- 1) ([Heparan sulfate]-glucosamine N-sulfotransferase 1) (HSNST 1) (N- heparan sulfate sulfotransferase 1) (N-HSST 1) [Inc

Features of the cloned cDNA sequence

Description

Length: 5937 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3012 bp
Genome contig ID	gi51511721f_149780621
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CGAACTAACTGCTAATAAAGTGGGGTTCTGTTTGT
Flanking genome sequence (137346 - 137395)	----+--------+--------+--------+--------+----* ACACCTTGGTCCTGTCTGACCTTTTTGCAAGGCCCGCAGGGAAGGGTGGA

Features of the protein sequence

Description

Length: 698 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92344	100.0	N-deacetylase/N...	Homo sapiens
P52848	100.0	Bifunctional he...	Homo sapiens
XP_001108449	99.8	N-deacetylase/N...	Macaca mulatta
XP_001166515	99.7	N-deacetylase/N...	Pan troglodytes
AAA67765	99.7	heparan sulfate...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000863	420	683	PF00685	Sulphotransferase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp