Length: 4617 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
2061 bp |
Genome contig ID |
gi89161210r_31833415 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- GTTCAGCCTGCAGGTAAGTGGGAGAGCCCTTGCTC |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAGAAAAAGAAATAGTGGAAGACAAAAAGGAAAGGACACTA |
Length: 156 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92248 |
2.2e-68 |
100.0 |
neuraminidase p...
|
Homo sapiens
|
EAX03537 |
3.7e-65 |
100.0 |
sialidase 1 (ly...
|
Homo sapiens
|
BAF83655 |
6.1e-65 |
100.0 |
unnamed protein...
|
Homo sapiens
|
Q5RAF4 |
6.1e-65 |
100.0 |
Sialidase-1; Ly...
|
Pongo abelii
|
AAP36936 |
6.1e-65 |
100.0 |
sialidase 1 (ly...
|
synthetic construct
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.