Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06134
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209011
Product ID ORK06134
Clone name hg02275
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NEU1
cDNA sequence DNA sequence (4617 bp)
Predicted protein sequence (156 aa)
Description Sialidase-1 precursor (EC 3.2.1.18) (Lysosomal sialidase) (N-acetyl- alpha-neuraminidase 1) (Acetylneuraminyl hydrolase) (G9 sialidase).
Features of the cloned cDNA sequence

Length: 4617 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 2061 bp
Genome contig ID gi89161210r_31833415
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTTCAGCCTGCAGGTAAGTGGGAGAGCCCTTGCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGAAAAAGAAATAGTGGAAGACAAAAAGGAAAGGACACTA

Features of the protein sequence

Length: 156 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92248 2.2e-68 100.0 neuraminidase p...
Homo sapiens
EAX03537 3.7e-65 100.0 sialidase 1 (ly...
Homo sapiens
BAF83655 6.1e-65 100.0 unnamed protein...
Homo sapiens
Q5RAF4 6.1e-65 100.0 Sialidase-1; Ly...
Pongo abelii
AAP36936 6.1e-65 100.0 sialidase 1 (ly...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp