Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06166
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209300
Product ID ORK06166
Clone name fk07858
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NLRP2
cDNA sequence DNA sequence (3418 bp)
Predicted protein sequence (761 aa)
Description NACHT, LRR and PYD domains-containing protein 2 (PYRIN domain and NACHT domain-containing protein 1) (PYRIN-containing APAF1-like protein 2) (Nucleotide-binding site protein 1).
Features of the cloned cDNA sequence

Length: 3418 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1099 bp
Genome contig ID gi42406306f_60068509
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GGTATATTGAGAGAAATAAAGGTGAGAGCATTCAC
Flanking genome sequence
(135808 - 135857)
----+----*----+----*----+----*----+----*----+----*
AAATGAAGCTGTTACTTAATAATGGGCTTTGACAAGTTAGAGAAAAGATA

Features of the protein sequence

Length: 761 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92537 0 100.0 NACHT, leucine ...
Homo sapiens
CAQ09222 0 99.8 NACHT, leucine ...
Homo sapiens
XP_001175068 0 98.3 NACHT, leucine ...
Pan troglodytes
CAQ09223 0 97.1 NACHT, leucine ...
Homo sapiens
EAW72318 0 97.0 NACHT, leucine ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004020 18 101 PF02758 Pyrin
IPR007111 194 362 PF05729 NACHT nucleoside triphosphatase
ProfileScan IPR004020 12 105 PS50824 Pyrin
IPR007111 194 392 PS50837 NACHT nucleoside triphosphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp