ORK06286

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06286

Order Kazusa clone(s) from :

Accession No	AB209009
Product ID	ORK06286
Clone name	hg01279
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCCB
cDNA sequence	DNA sequence (6086 bp) Predicted protein sequence (556 aa)
Description	Propionyl-CoA carboxylase beta chain, mitochondrial precursor (EC 6.4.1.3) (PCCase subunit beta) (Propanoyl-CoA:carbon dioxide ligase subunit beta).

Features of the cloned cDNA sequence

Description

Length: 6086 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4415 bp
Genome contig ID	gi89161205f_137351890
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AACAGGAAAATAAAGTTAAAAATATGTTTTTTTTT
Flanking genome sequence (187539 - 187588)	----+--------+--------+--------+--------+----* ACTCAATGTTGAGTTTTCATAAAACAGGTGTATAACAGTGTTTATCTTGA

Features of the protein sequence

Description

Length: 556 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92246	100.0	Propionyl Coenz...	Homo sapiens
XP_001115015	98.7	propionyl Coenz...	Macaca mulatta
P05166	99.8	Propionyl-CoA c...	Homo sapiens
CAA51825	99.6	propionyl-CoA c...	Homo sapiens
CAH92957	99.0	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000022	59	543	PF01039	Carboxyl transferase
ProfileScan	IPR011762	44	260	PS50980	Acetyl-coenzyme A carboxyltransferase
ProfileScan	IPR011763	261	537	PS50989	Acetyl-coenzyme A carboxyltransferase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp