Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06319
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209763
Product ID ORK06319
Clone name bj00372
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PDSS1
cDNA sequence DNA sequence (3900 bp)
Predicted protein sequence (297 aa)
Description Decaprenyl-diphosphate synthase subunit 1 (EC 2.5.1.-) (Decaprenyl pyrophosphate synthetase subunit 1) (Trans-prenyltransferase) (TPT).
Features of the cloned cDNA sequence

Length: 3900 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 701 bp
Genome contig ID gi89161187f_26928642
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GCCATTACACAAATAAATAACCAATGTTAAAATTC
Flanking genome sequence
(147090 - 147139)
----+----*----+----*----+----*----+----*----+----*
AAATGGTTTGTCTTGATTTACCGTAGGAGTAAAGGTCAGAAAAATGTGAA

Features of the protein sequence

Length: 297 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93000 1.2e-131 100.0 trans-prenyltra...
Homo sapiens
AAH63635 1.6e-100 100.0 PDSS1 protein [...
Homo sapiens
EAW86085 1.6e-100 100.0 prenyl (decapre...
Homo sapiens
AAH49211 2e-100 100.0 PDSS1 protein [...
Homo sapiens
Q5T2R2 2e-100 100.0 Decaprenyl-diph...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000092 127 297 PF00348 Polyprenyl synthetase
ScanRegExp IPR000092 184 198 PS00723 Polyprenyl synthetase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp