Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06326
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209917
Product ID ORK06326
Clone name ej00931
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ECI2
cDNA sequence DNA sequence (3870 bp)
Predicted protein sequence (232 aa)
Description Peroxisomal 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) (Dodecenoyl-CoA isomerase) (Delta(3),delta(2)-enoyl-CoA isomerase) (D3,D2-enoyl-CoA isomerase) (DBI-related protein 1) (DRS-1) (Hepatocellular carcinoma- associated antigen 88) (Renal carcinoma antige
Features of the cloned cDNA sequence

Length: 3870 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3171 bp
Genome contig ID gi89161210r_3960941
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACTACAGCTCTGATGAATAAAAAGTTTTGTAAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGCTTAAGAATTCACACAGGTGTTTGGTAGTAGAGAGTCTTACGTCTTT

Features of the protein sequence

Length: 232 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93154 4.1e-95 100.0 peroxisomal D3,...
Homo sapiens
ACE86755 3.7e-84 96.3 peroxisomal D3,...
synthetic construct
EAW55163 3.7e-84 96.3 peroxisomal D3,...
Homo sapiens
CAI42127 3.7e-84 96.3 peroxisomal D3,...
Homo sapiens
AAP36349 3.7e-84 96.3 peroxisomal D3,...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000582 50 120 PD351532 Acyl-coA-binding protein
FPrintScan IPR000582 47 62 PR00689 Acyl-coA-binding protein
IPR000582 64 82 PR00689 Acyl-coA-binding protein
IPR000582 87 102 PR00689 Acyl-coA-binding protein
IPR000582 108 125 PR00689 Acyl-coA-binding protein
HMMPfam IPR000582 46 130 PF00887 Acyl-coA-binding protein
IPR001753 158 213 PF00378 Crotonase
ProfileScan IPR000582 46 131 PS51228 Acyl-coA-binding protein
ScanRegExp IPR000582 64 82 PS00880 Acyl-coA-binding protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp