Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06331
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209355
Product ID ORK06331
Clone name fh15103
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PEX1
cDNA sequence DNA sequence (5333 bp)
Predicted protein sequence (235 aa)
Description Peroxisome biogenesis factor 1 (Peroxin-1) (Peroxisome biogenesis disorder protein 1).
Features of the cloned cDNA sequence

Length: 5333 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 594 bp
Genome contig ID gi89161213r_91854276
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CACTGTTTTGAAATAAAATATCCTATTACCTACTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATACAATTATCTGTTCTTTGTATATCAAAAAATGTGAAATTTACACATAA

Features of the protein sequence

Length: 235 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92592 2.3e-92 100.0 peroxisome biog...
Homo sapiens
BAB59061 9.8e-77 99.5 Pex1p-634del690...
Homo sapiens
BAB59062 1e-76 99.5 Pex1pL664P [Hom...
Homo sapiens
BAF85644 1e-76 99.5 unnamed protein...
Homo sapiens
O43933 1e-76 99.5 Peroxisome biog...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003959 20 68 PF00004 AAA ATPase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp