Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06373
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209130
Product ID ORK06373
Clone name fg01928
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PITPNM3
cDNA sequence DNA sequence (5377 bp)
Predicted protein sequence (879 aa)
Description Membrane-associated phosphatidylinositol transfer protein 3 (Phosphatidylinositol transfer protein, membrane-associated 3) (Pyk2 N-terminal domain-interacting receptor 1) (NIR-1).
Features of the cloned cDNA sequence

Length: 5377 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi51511734r_6199444
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGCCCAGAGCCAGCCCGAGTCGGACAAAGACCACG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCGGCCGCTGCCGGCGCTCAGCTGGGCGCGTGGGCCCCCCAAGTTCGAG

Features of the protein sequence

Length: 879 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92367 0 100.0 Hypothetical pr...
Homo sapiens
CAB97544 0 98.7 hypothetical pr...
Homo sapiens
Q9BZ71 0 98.7 Membrane-associ...
Homo sapiens
EAW90305 0 98.5 PITPNM family m...
Homo sapiens
EAW90304 0 98.5 PITPNM family m...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom NULL 681 727 PD105831 NULL
HMMPfam IPR004177 315 519 PF02862 DDHD
IPR013209 664 795 PF08235 LNS2
HMMSmart IPR013209 664 795 SM00775 LNS2
ProfileScan IPR004177 315 519 PS51043 DDHD
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp