Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06375
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226171
Product ID ORK06375
Clone name bm01524
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PJA1
cDNA sequence DNA sequence (2005 bp)
Predicted protein sequence (629 aa)
Flexi ORF Clone FXC06375
Description E3 ubiquitin-protein ligase Praja1 (EC 6.3.2.-) (Praja-1) (RING finger protein 70).
Features of the cloned cDNA sequence

Length: 2005 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 113 bp
Genome contig ID gi89161218r_68197762
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
AACAATGGAAATAAAACCAATCAGTCAGTTAGCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACCTATTGATTCCTCGTGATTATTTCCAATGTGAAAACAGTTGTGTAT

Features of the protein sequence

Length: 629 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8NG27 0 99.0 E3 ubiquitin-pr...
Homo sapiens
BAF83232 0 98.8 unnamed protein...
Homo sapiens
BAG53338 0 98.8 unnamed protein...
Homo sapiens
CAM24741 7.2e-214 100.0 praja 1 [Homo s...
Homo sapiens
CAH93231 3.4e-209 97.9 hypothetical pr...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001841 581 621 PF00097 Zinc finger
HMMSmart IPR001841 581 621 SM00184 Zinc finger
ProfileScan IPR001841 581 622 PS50089 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp