Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06394
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208908
Product ID ORK06394
Clone name sj00191
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PLEKHA4
cDNA sequence DNA sequence (4574 bp)
Predicted protein sequence (382 aa)
Description Pleckstrin homology domain-containing family A member 4 (Phosphoinositol 3-phosphate-binding protein 1) (PEPP-1).
Features of the cloned cDNA sequence

Length: 4574 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 2822 bp
Genome contig ID gi42406306r_53932167
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
CACTGTCTAAATTTGGATTAAAACTTTGAACTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTCAATAGCTTTCTTTCTGTCTGTCTGGGGTTGTGGCACTGGTGTCTCT

Features of the protein sequence

Length: 382 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92145 4.4e-106 100.0 Pleckstrin homo...
Homo sapiens
Q9H4M7 3.5e-84 99.3 Pleckstrin homo...
Homo sapiens
EAW52408 3.5e-84 99.3 pleckstrin homo...
Homo sapiens
AAG01896 3.5e-84 99.3 phosphoinositol...
Homo sapiens
EAW52407 3.5e-84 99.3 pleckstrin homo...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001849 56 123 PF00169 Pleckstrin-like
ProfileScan IPR001849 89 123 PS50003 Pleckstrin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp