Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06424
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209867
Product ID ORK06424
Clone name ef03678
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol POLQ
cDNA sequence DNA sequence (8507 bp)
Predicted protein sequence (2214 aa)
Description DNA polymerase theta (EC 2.7.7.7) (DNA polymerase eta).
Features of the cloned cDNA sequence

Length: 8507 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 678 bp
Genome contig ID gi89161205r_122533163
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAAACTATACCTCTTCAAGAGGTATCCTGTTCTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGATCAGATGTTTTTATTGCAGGTCAATATAATACTGCCAGAGACAGAA

Features of the protein sequence

Length: 2214 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93104 0 100.0 DNA polymerase ...
Homo sapiens
AAR08421 0 100.0 DNA polymerase ...
Homo sapiens
EAW79513 0 99.9 polymerase (DNA...
Homo sapiens
EAW79510 0 99.9 polymerase (DNA...
Homo sapiens
NP_955452 0 99.9 DNA polymerase ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002298 1852 1874 PR00868 DNA polymerase A
IPR002298 2094 2110 PR00868 DNA polymerase A
HMMPfam IPR001650 30 109 PF00271 DNA/RNA helicase
IPR001098 1718 2209 PF00476 DNA-directed DNA polymerase
HMMSmart IPR001650 23 109 SM00490 DNA/RNA helicase
IPR001098 1935 2174 SM00482 DNA-directed DNA polymerase
ProfileScan IPR001650 1 178 PS51194 DNA/RNA helicase
ScanRegExp IPR001098 2003 2022 PS00447 DNA-directed DNA polymerase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp