Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06467
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209811
Product ID ORK06467
Clone name bm04221
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PPP2R5E
cDNA sequence DNA sequence (1851 bp)
Predicted protein sequence (502 aa)
Description Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit epsilon isoform (PP2A, B subunit, B' epsilon isoform) (PP2A, B subunit, B56 epsilon isoform) (PP2A, B subunit, PR61 epsilon isoform) (PP2A, B subunit, R5 epsilon isoform).
Features of the cloned cDNA sequence

Length: 1851 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi51511730r_62818527
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGACAGCCACATACAAGTCAGATCGTCAGCGTGAG
Flanking genome sequence
(99999 - 99950)
----+----*----+----*----+----*----+----*----+----*
TAACTTTTTAAAGCTTTTTTGTCAGCTGTGCATAAAGCTATTGAGTTTTT

Features of the protein sequence

Length: 502 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93048 5.3e-155 100.0 epsilon isoform...
Homo sapiens
AAH64358 6e-132 100.0 PPP2R5E protein...
Homo sapiens
Q16537 6.2e-132 100.0 Serine/threonin...
Homo sapiens
Q61151 8.7e-132 99.7 Serine/threonin...
Mus musculus
AAH92477 1.1e-131 99.7 Protein phospha...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002554 113 502 PF01603 Protein phosphatase 2A
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp