Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06495
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209472
Product ID ORK06495
Clone name ah05123
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PRODH
cDNA sequence DNA sequence (4676 bp)
Predicted protein sequence (284 aa)
Description Proline oxidase, mitochondrial precursor (EC 1.5.99.8) (Proline dehydrogenase) (Proline oxidase 2) (P53-induced gene 6 protein).
Features of the cloned cDNA sequence

Length: 4676 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 393 bp
Genome contig ID gi89161203r_17180295
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GGAGGCCTGCCTGGTCAATAAACCACTGTTCCTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCTGAGAGCCCTTTGCCCTCACACAGGGTCAGCTCTGGGCAACAAAGAG

Features of the protein sequence

Length: 284 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92709 1e-120 100.0 Proline oxidase...
Homo sapiens
AAI21810 3.8e-109 98.5 PRODH protein [...
Homo sapiens
AAB88789 3.9e-109 98.5 proline dehydro...
Homo sapiens
O43272 3.9e-109 98.5 Proline dehydro...
Homo sapiens
AAH94736 4.1e-109 98.5 PRODH protein [...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002872 3 266 PF01619 Proline dehydrogenase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp