Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06500
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226091
Product ID ORK06500
Clone name bm05725
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PRSS16
cDNA sequence DNA sequence (1721 bp)
Predicted protein sequence (116 aa)
Description Thymus-specific serine protease precursor (EC 3.4.-.-) (Serine protease 16).
Features of the cloned cDNA sequence

Length: 1721 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1329 bp
Genome contig ID gi89161210f_27227434
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTATTTTCAGCAATAAATACTTCTCAGCTTTTTGT
Flanking genome sequence
(104782 - 104831)
----+----*----+----*----+----*----+----*----+----*
ATGTCTTTGTATGCACAGAGATGGTAGTTTTAGAGTTTTATCCAGTTTCA

Features of the protein sequence

Length: 116 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NQE7 1.8e-34 98.9 Thymus-specific...
Homo sapiens
CAB94769 1.9e-34 98.9 protease, serin...
Homo sapiens
XP_518296 4.2e-34 97.9 protease, serin...
Pan troglodytes
XP_001136226 4.6e-34 97.9 protease, serin...
Pan troglodytes
XP_001136145 4.8e-34 97.9 protease, serin...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR008758 10 110 PF05577 Peptidase S28
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp