Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06519
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209220
Product ID ORK06519
Clone name fj12194
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PSMD14
cDNA sequence DNA sequence (4891 bp)
Predicted protein sequence (163 aa)
Description 26S proteasome non-ATPase regulatory subunit 14 (26S proteasome regulatory subunit rpn11) (26S proteasome-associated PAD1 homolog 1).
Features of the cloned cDNA sequence

Length: 4891 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 315 bp
Genome contig ID gi89161199f_161846117
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GATTGTCACTTACAAAATAAAATACATTTACAGTC
Flanking genome sequence
(130357 - 130406)
----+----*----+----*----+----*----+----*----+----*
TATGCCTCCTGAGATCTTTTTGGCAATGGGTGGGATTGATGGAATAACAT

Features of the protein sequence

Length: 163 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92457 1e-64 100.0 26S proteasome-...
Homo sapiens
AAY15016 8.5e-62 100.0 unknown [Homo s...
Homo sapiens
EDL26979 1e-61 99.3 proteasome (pro...
Mus musculus
CAA73514 1.1e-61 99.3 26S proteasome,...
Mus musculus
BAE29436 1.1e-61 99.3 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp