Length: 4891 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
315 bp |
Genome contig ID |
gi89161199f_161846117 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- GATTGTCACTTACAAAATAAAATACATTTACAGTC |
Flanking genome sequence (130357 - 130406) |
----+----*----+----*----+----*----+----*----+----* TATGCCTCCTGAGATCTTTTTGGCAATGGGTGGGATTGATGGAATAACAT |
Length: 163 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92457 |
1e-64 |
100.0 |
26S proteasome-...
|
Homo sapiens
|
AAY15016 |
8.5e-62 |
100.0 |
unknown [Homo s...
|
Homo sapiens
|
EDL26979 |
1e-61 |
99.3 |
proteasome (pro...
|
Mus musculus
|
CAA73514 |
1.1e-61 |
99.3 |
26S proteasome,...
|
Mus musculus
|
BAE29436 |
1.1e-61 |
99.3 |
unnamed protein...
|
Mus musculus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.