ORK06546

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06546

Order Kazusa clone(s) from :

Accession No	AB209034
Product ID	ORK06546
Clone name	hh01184
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PXN
cDNA sequence	DNA sequence (5457 bp) Predicted protein sequence (713 aa)
Description	Paxillin.

Features of the cloned cDNA sequence

Description

Length: 5457 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3247 bp
Genome contig ID	gi89161190r_119032637
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCTGTGATTTATGCCAATAAAGTTTGCCCATGATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTCACCTGTGCTAGTGCTATTTCTTGGTGGTCTGAACCTCATGGTCCCAG

Features of the protein sequence

Description

Length: 713 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92271	0	100.0	Paxillin varian...	Homo sapiens
XP_001159707	0	98.8	similar to Paxi...	Pan troglodytes
BAA18998	1.3e-80	81.9	paxillin gamma ...	Homo sapiens
AAC05175	3e-80	81.6	cytoskeletal pr...	Homo sapiens
AAC50104	1.5e-79	92.5	paxillin [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001904	27	49	PR00832	Paxillin
	IPR001904	50	73	PR00832	Paxillin
	IPR001904	74	96	PR00832	Paxillin
	IPR001904	120	139	PR00832	Paxillin
	IPR001904	144	166	PR00832	Paxillin
	IPR001904	169	192	PR00832	Paxillin
	IPR001904	205	226	PR00832	Paxillin
	IPR001904	227	246	PR00832	Paxillin
	IPR001904	247	266	PR00832	Paxillin
HMMPfam	IPR001904	51	260	PF03535	Paxillin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp