ORK06619

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06619

Order Kazusa clone(s) from :

Accession No	AB209223
Product ID	ORK06619
Clone name	fj13058
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RDH11
cDNA sequence	DNA sequence (4036 bp) Predicted protein sequence (140 aa)
Description	Retinol dehydrogenase 11 (EC 1.1.1.-) (Retinal reductase 1) (RalR1) (Prostate short-chain dehydrogenase/reductase 1) (Androgen-regulated short-chain dehydrogenase/reductase 1) (HCV core-binding protein HCBP12).

Features of the cloned cDNA sequence

Description

Length: 4036 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	158 bp
Genome contig ID	gi51511730r_67113863
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGACTGATGAGGTCTTAACAAAAACCAGTGTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAATCCTAAAAACAAACAAACAAA

Features of the protein sequence

Description

Length: 140 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92460	5.1e-66	100.0	androgen-regula...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	59	TPPLLKIVYIFVCLPVYVCQGSI	81	PRIMARY	23