Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06629
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208937
Product ID ORK06629
Clone name ah04962
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol REPS2
cDNA sequence DNA sequence (5804 bp)
Predicted protein sequence (514 aa)
Description RalBP1-associated Eps domain-containing protein 2 (RalBP1-interacting protein 2) (Partner of RalBP1).
Features of the cloned cDNA sequence

Length: 5804 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4257 bp
Genome contig ID gi89161218f_16834269
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGGGGTGCTATGTTAAAAATAAATGTATGATAACT
Flanking genome sequence
(247047 - 247096)
----+----*----+----*----+----*----+----*----+----*
AAGTGTGGGTTTTATGGAGTCTTGGTGTCGATATATTGTGGTTTGCATTT

Features of the protein sequence

Length: 514 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92174 1.3e-163 100.0 RalBP1 associat...
Homo sapiens
XP_001138988 3e-152 100.0 RALBP1 associat...
Pan troglodytes
Q8NFH8 3.3e-152 100.0 RalBP1-associat...
Homo sapiens
AAM43933 2.8e-151 99.7 RALBP1 associat...
Homo sapiens
XP_001490539 1.3e-142 92.5 RALBP1 associat...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR000261 182 277 SM00027 EPS15 homology (EH)
ProfileScan IPR000261 189 274 PS50031 EPS15 homology (EH)
IPR002048 222 257 PS50222 Calcium-binding EF-hand
ScanRegExp IPR002048 235 247 PS00018 Calcium-binding EF-hand
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp