Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06695
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209667
Product ID ORK06695
Clone name pf02319
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RPS6KA5
cDNA sequence DNA sequence (7939 bp)
Predicted protein sequence (106 aa)
Description Ribosomal protein S6 kinase alpha-5 (EC 2.7.11.1) (Nuclear mitogen- and stress-activated protein kinase 1) (90 kDa ribosomal protein S6 kinase 5) (RSK-like protein kinase) (RSKL).
Features of the cloned cDNA sequence

Length: 7939 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2018 bp
Genome contig ID gi51511730r_90307601
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
ATAACCTGCTATTATTAAACTTTTTCTAAAAAGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGATATAAGAACTCAAGGTCCCATACTCTGTATTCG

Features of the protein sequence

Length: 106 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92904 3.7e-46 100.0 Putative p150 v...
Homo sapiens
CAB43270 5.3e-20 98.2 hypothetical pr...
Homo sapiens
BAE35993 1.5e-19 98.2 unnamed protein...
Mus musculus
EDL18896 1.8e-19 98.2 ribosomal prote...
Mus musculus
XP_001506738 2e-19 98.2 similar to nucl...
Ornithorhynchus...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp