Length: 7939 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
2018 bp |
Genome contig ID |
gi51511730r_90307601 |
PolyA signal sequence (ATTAAA,-22) |
+----*----+----*----+----*----+---- ATAACCTGCTATTATTAAACTTTTTCTAAAAAGTG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAGATATAAGAACTCAAGGTCCCATACTCTGTATTCG |
Length: 106 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92904 |
3.7e-46 |
100.0 |
Putative p150 v...
|
Homo sapiens
|
CAB43270 |
5.3e-20 |
98.2 |
hypothetical pr...
|
Homo sapiens
|
BAE35993 |
1.5e-19 |
98.2 |
unnamed protein...
|
Mus musculus
|
EDL18896 |
1.8e-19 |
98.2 |
ribosomal prote...
|
Mus musculus
|
XP_001506738 |
2e-19 |
98.2 |
similar to nucl...
|
Ornithorhynchus...
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.