Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06717
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209425
Product ID ORK06717
Clone name pg01051
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RYR1
cDNA sequence DNA sequence (6266 bp)
Predicted protein sequence (1232 aa)
Description Ryanodine receptor 1 (Skeletal muscle-type ryanodine receptor) (RyR1) (RYR-1) (Skeletal muscle calcium release channel).
Features of the cloned cDNA sequence

Length: 6266 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi42406306f_43578694
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCACGGCGGCGGCGGGGGCGACGGCGCGGGTTGTG
Flanking genome sequence
(169016 - 169065)
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCAGGCCGGGCCCTGCGAGGCCTCAGCTACCGCAGCCTGCGGCG

Features of the protein sequence

Length: 1232 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92662 0 100.0 ryanodine recep...
Homo sapiens
EAW56795 0 99.5 ryanodine recep...
Homo sapiens
NP_001036188 0 99.5 ryanodine recep...
Homo sapiens
AAA60294 0 99.4 ryanodine recep...
Homo sapiens
CAA44674 0 97.0 calcium release...
Sus scrofa
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR002048 1009 1061 PD000012 Calcium-binding EF-hand
HMMPfam IPR013662 449 938 PF08454 RyR and IP3R Homology associated
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp