Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06756
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208940
Product ID ORK06756
Clone name fk09723
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SECISBP2
cDNA sequence DNA sequence (3404 bp)
Predicted protein sequence (561 aa)
Description SECIS-binding protein 2 (Selenocysteine insertion sequence-binding protein 2).
Features of the cloned cDNA sequence

Length: 3404 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 815 bp
Genome contig ID gi89161216f_91023250
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GAGGGCTTATTTATTTTAAATAAAGAGTAATTATT
Flanking genome sequence
(141126 - 141175)
----+----*----+----*----+----*----+----*----+----*
AAATTTTGTTTCAGACTCTGGTGATTTTAGGCTTCTCAGTGGTCTCTGTC

Features of the protein sequence

Length: 561 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92177 1.3e-199 100.0 hypothetical pr...
Homo sapiens
CAB66815 1.9e-195 98.9 hypothetical pr...
Homo sapiens
Q96T21 2.1e-195 98.9 Selenocysteine ...
Homo sapiens
BAG61209 2.9e-195 98.7 unnamed protein...
Homo sapiens
AAH36109 4e-195 98.7 SECIS binding p...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004038 364 466 PF01248 Ribosomal protein L7Ae/L30e/S12e/Gadd45
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp