Length: 3404 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
815 bp |
| Genome contig ID |
gi89161216f_91023250 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- GAGGGCTTATTTATTTTAAATAAAGAGTAATTATT |
Flanking genome sequence (141126 - 141175) |
----+----*----+----*----+----*----+----*----+----* AAATTTTGTTTCAGACTCTGGTGATTTTAGGCTTCTCAGTGGTCTCTGTC |
Length: 561 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92177 |
1.3e-199 |
100.0 |
hypothetical pr...
|
Homo sapiens
|
| CAB66815 |
1.9e-195 |
98.9 |
hypothetical pr...
|
Homo sapiens
|
| Q96T21 |
2.1e-195 |
98.9 |
Selenocysteine ...
|
Homo sapiens
|
| BAG61209 |
2.9e-195 |
98.7 |
unnamed protein...
|
Homo sapiens
|
| AAH36109 |
4e-195 |
98.7 |
SECIS binding p...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method |
interpro_ID |
From |
To |
Entry |
Definition |
| HMMPfam |
IPR004038 |
364 |
466 |
PF01248 |
Ribosomal protein L7Ae/L30e/S12e/Gadd45 |