Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06790
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209349
Product ID ORK06790
Clone name fh13607
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SETDB2
cDNA sequence DNA sequence (5424 bp)
Predicted protein sequence (262 aa)
Description Histone-lysine N-methyltransferase SETDB2 (EC 2.1.1.43) (SET domain bifurcated 2) (Chronic lymphocytic leukemia deletion region gene 8 protein).
Features of the cloned cDNA sequence

Length: 5424 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 677 bp
Genome contig ID gi51511729f_48848959
PolyA signal sequence
(ATTAAA,-31)
+----*----+----*----+----*----+----
TCATATTAAACTTACTTTGTGAAAACTTTTTGTTT
Flanking genome sequence
(112682 - 112731)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGCCATACCTTGAGAAGTACTGTGCTCCTGTTCCC

Features of the protein sequence

Length: 262 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92586 1.6e-117 100.0 CLLL8 protein v...
Homo sapiens
EAX08825 4.5e-86 99.0 SET domain, bif...
Homo sapiens
CAI10818 5e-86 99.0 SET domain, bif...
Homo sapiens
EAX08826 8.3e-86 99.4 SET domain, bif...
Homo sapiens
Q96T68 8.4e-86 99.4 Histone-lysine ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007728 60 77 PF05033 Pre-SET zinc-binding region
IPR001214 79 126 PF00856 SET
ProfileScan IPR001214 84 236 PS50280 SET
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp