Length: 7047 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
0 bp |
Genome contig ID |
gi51511721f_65395167 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- TAGATCTCCGTCCCCCAGGAGCAGAAATAAGAAGG |
Flanking genome sequence (113946 - 113995) |
----+----*----+----*----+----*----+----*----+----* ATAAAAAGAGAGAAAAAGAAAGGGACCACATCAGTGAAAGAAGAGAGAGA |
Length: 206 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92931 |
2e-47 |
100.0 |
splicing factor...
|
Homo sapiens
|
Q8WXA9 |
8e-45 |
100.0 |
Splicing factor...
|
Homo sapiens
|
EAW51329 |
8.9e-45 |
100.0 |
splicing factor...
|
Homo sapiens
|
EAW51331 |
4.4e-44 |
99.4 |
splicing factor...
|
Homo sapiens
|
XP_001162337 |
7.6e-44 |
98.5 |
splicing factor...
|
Pan troglodytes
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.