Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06799
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209694
Product ID ORK06799
Clone name pf10365
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SREK1
cDNA sequence DNA sequence (7047 bp)
Predicted protein sequence (206 aa)
Description Splicing factor, arginine/serine-rich 12 (Serine-arginine-rich- splicing regulatory protein 86) (SRrp86) (Splicing regulatory protein 508) (SRrp508).
Features of the cloned cDNA sequence

Length: 7047 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi51511721f_65395167
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAGATCTCCGTCCCCCAGGAGCAGAAATAAGAAGG
Flanking genome sequence
(113946 - 113995)
----+----*----+----*----+----*----+----*----+----*
ATAAAAAGAGAGAAAAAGAAAGGGACCACATCAGTGAAAGAAGAGAGAGA

Features of the protein sequence

Length: 206 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92931 2e-47 100.0 splicing factor...
Homo sapiens
Q8WXA9 8e-45 100.0 Splicing factor...
Homo sapiens
EAW51329 8.9e-45 100.0 splicing factor...
Homo sapiens
EAW51331 4.4e-44 99.4 splicing factor...
Homo sapiens
XP_001162337 7.6e-44 98.5 splicing factor...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp