Length: 5640 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
1868 bp |
Genome contig ID |
gi89161216r_135226466 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- GCAACGAGAGTGAAACTCCGTCCCCACCCCCTGCC |
Flanking genome sequence (99710 - 99661) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAAAGCCAGGGCAAAGGACCTGGCGTGGCCACTTCC |
Length: 310 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92345 |
7e-123 |
100.0 |
solute carrier ...
|
Homo sapiens
|
XP_528524 |
2.7e-16 |
94.1 |
solute carrier ...
|
Pan troglodytes
|
Q9UGQ3 |
3.1e-16 |
94.1 |
Solute carrier ...
|
Homo sapiens
|
CAB66155 |
3.1e-16 |
94.1 |
sugar transport...
|
Homo sapiens
|
XP_001118379 |
1e-15 |
55.1 |
solute carrier ...
|
Macaca mulatta
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.