Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06866
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209108
Product ID ORK06866
Clone name hh06443
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SLC2A6
cDNA sequence DNA sequence (5640 bp)
Predicted protein sequence (310 aa)
Description Solute carrier family 2, facilitated glucose transporter member 6 (Glucose transporter type 6) (GLUT-6) (Glucose transporter type 9) (GLUT-9).
Features of the cloned cDNA sequence

Length: 5640 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1868 bp
Genome contig ID gi89161216r_135226466
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCAACGAGAGTGAAACTCCGTCCCCACCCCCTGCC
Flanking genome sequence
(99710 - 99661)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGCCAGGGCAAAGGACCTGGCGTGGCCACTTCC

Features of the protein sequence

Length: 310 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92345 7e-123 100.0 solute carrier ...
Homo sapiens
XP_528524 2.7e-16 94.1 solute carrier ...
Pan troglodytes
Q9UGQ3 3.1e-16 94.1 Solute carrier ...
Homo sapiens
CAB66155 3.1e-16 94.1 sugar transport...
Homo sapiens
XP_001118379 1e-15 55.1 solute carrier ...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp