ORK06909

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06909

Order Kazusa clone(s) from :

Accession No	AB209775
Product ID	ORK06909
Clone name	bm01791
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SMPD1
cDNA sequence	DNA sequence (2452 bp) Predicted protein sequence (664 aa)
Description	Sphingomyelin phosphodiesterase precursor (EC 3.1.4.12) (Acid sphingomyelinase) (aSMase).

Features of the cloned cDNA sequence

Description

Length: 2452 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	388 bp
Genome contig ID	gi51511727f_6268237
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AGTCTGTTAAAATAAAGATAAGAGACTTGGACTCC
Flanking genome sequence (104566 - 104615)	----+--------+--------+--------+--------+----* AGACCCCTGTGTGACTGTCCCAATTTCTTCTTTCCAGGCAAGCAGGGCAA

Features of the protein sequence

Description

Length: 664 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD93012	100.0	sphingomyelin p...	Homo sapiens
EAW68728	99.8	sphingomyelin p...	Homo sapiens
AAA75008	99.6	acid sphingomye...	Homo sapiens
P17405	99.3	Sphingomyelin p...	Homo sapiens
AAA58377	99.2	acid sphingomye...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004843	234	496	PF00149	Metallophosphoesterase
HMMSmart	IPR008139	122	200	SM00741	Saposin B
ProfileScan	IPR008139	120	204	PS50015	Saposin B

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	59	GAPGLLWMGLALALALALALALA	81	PRIMARY	23