ORK07019

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07019

Order Kazusa clone(s) from :

Accession No
Product ID	ORK07019
Clone name	bm01714
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	STX12
cDNA sequence	DNA sequence (2326 bp) Predicted protein sequence (294 aa)
HaloTag ORF Clone	FHC07019
Flexi ORF Clone	FXC07019
Description	syntaxin 12

Features of the cloned cDNA sequence

Description

Length: 2326 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1439 bp
Genome contig ID	gi89161185f_27872350
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CACTTACTTAATACAAATAAATGTTTTTTAAAGCT
Flanking genome sequence (150518 - 150567)	----+--------+--------+--------+--------+----* TTTGTAGTATGTTTTTATGAGTTAACATCCTAATGTGGTAGGTATTAGGT

Features of the protein sequence

Description

Length: 294 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86Y82	1.6e-87	100.0	Syntaxin-12.	Homo sapiens
Q5RBW6	1.2e-86	98.9	Syntaxin-12.	Pongo abelii
XP_001150085	1.2e-86	98.9	syntaxin 12 iso...	Pan troglodytes
XP_001112101	2.5e-86	98.5	similar to synt...	Macaca mulatta
CAA22911	9.8e-85	100.0	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006011	36	132	PF00804	Syntaxin
HMMPfam	IPR000727	201	263	PF05739	Target SNARE coiled-coil region
HMMSmart	IPR006011	32	147	SM00503	Syntaxin
HMMSmart	IPR000727	191	258	SM00397	Target SNARE coiled-coil region
ProfileScan	IPR000727	196	258	PS50192	Target SNARE coiled-coil region
ScanRegExp	IPR006012	202	241	PS00914	Syntaxin/epimorphin coiled-coil

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	270	CILVLVLSVIILILGLIIWLVY	291	PRIMARY	22