Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07257
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226090
Product ID ORK07257
Clone name bm05546
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TXNIP
cDNA sequence DNA sequence (1972 bp)
Predicted protein sequence (397 aa)
Flexi ORF Clone FXC07257
Description Thioredoxin-interacting protein (Vitamin D3 up-regulated protein 1) (Thioredoxin-binding protein 2).
Features of the cloned cDNA sequence

Length: 1972 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 519 bp
Genome contig ID gi89161185f_144049883
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTAAAATCAGTGTTTCCCCTTTGTGCACTTGTAG
Flanking genome sequence
(103213 - 103262)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAGAAAAACCTTCTAGAGCTGATTTGATGGACAATGGAGAGAGC

Features of the protein sequence

Length: 397 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9H3M7 1.8e-167 100.0 Thioredoxin-int...
Homo sapiens
AAB31977 2.8e-167 99.7 brain-expressed...
Homo sapiens
XP_001156564 1.1e-166 99.2 similar to dihy...
Pan troglodytes
XP_001092636 1.5e-166 99.2 similar to thio...
Macaca mulatta
Q5R811 1.8e-166 99.2 Thioredoxin-int...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR011021 16 158 PF00339 Arrestin-like
IPR011022 180 307 PF02752 Arrestin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp