ORK07258

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07258

Order Kazusa clone(s) from :

Accession No	AB209263
Product ID	ORK07258
Clone name	fk01540
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TXNL1
cDNA sequence	DNA sequence (3542 bp) Predicted protein sequence (280 aa)
Description	Thioredoxin-like protein 1 (32 kDa thioredoxin-related protein).

Features of the cloned cDNA sequence

Description

Length: 3542 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2697 bp
Genome contig ID	gi51511735r_52326508
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTATATTGTACAAAGTAACAACTTCAATGTAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAAGAGGGTTTACATGTAACTGAAATTGGCCAGCTTAGTC

Features of the protein sequence

Description

Length: 280 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92500	2.2e-122	100.0	thioredoxin-lik...	Homo sapiens
XP_001137336	2.2e-122	100.0	thioredoxin-lik...	Pan troglodytes
XP_001083608	7e-122	99.6	thioredoxin-lik...	Macaca mulatta
O43396	6.4e-121	100.0	Thioredoxin-lik...	Homo sapiens
AAX43911	6.5e-121	100.0	thioredoxin-lik...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006662	28	37	PR00421	Thioredoxin-related
FPrintScan	IPR006662	67	78	PR00421	Thioredoxin-related
HMMPfam	IPR013766	29	101	PF00085	Thioredoxin domain
HMMPfam	IPR010400	147	264	PF06201	Protein of unknown function DUF1000
ScanRegExp	IPR006662	21	39	PS00194	Thioredoxin-related

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp