Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07261
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208872
Product ID ORK07261
Clone name hh11934
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol UBA2
cDNA sequence DNA sequence (1559 bp)
Predicted protein sequence (295 aa)
Description SUMO-activating enzyme subunit 2 (EC 6.3.2.-) (Ubiquitin-like 1- activating enzyme E1B) (Anthracycline-associated resistance ARX).
Features of the cloned cDNA sequence

Length: 1559 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 669 bp
Genome contig ID gi42406306f_39537003
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TTATGGACCAAATAAATGGCATCTGCATTCTTGTT
Flanking genome sequence
(115634 - 115683)
----+----*----+----*----+----*----+----*----+----*
ACACATGCCTGCACAGTTCCTGTTTCTGCTGCCTTATATCTACTGCAGGA

Features of the protein sequence

Length: 295 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92109 1.1e-107 100.0 SUMO-1 activati...
Homo sapiens
XP_001155540 2.9e-107 99.6 SUMO-1 activati...
Pan troglodytes
BAG54081 3e-107 99.6 unnamed protein...
Homo sapiens
XP_001155603 3.3e-107 99.6 SUMO-1 activati...
Pan troglodytes
Q9UBT2 3.4e-107 99.6 SUMO-activating...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000127 1 68 PF02134 Ubiquitin-activating enzyme repeat
ScanRegExp IPR000011 59 67 PS00536 Ubiquitin-activating enzyme
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp