Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07263
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209782
Product ID ORK07263
Clone name bm02564
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol UBC
cDNA sequence DNA sequence (3996 bp)
Predicted protein sequence (1309 aa)
Description Ubiquitin.
Features of the cloned cDNA sequence

Length: 3996 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 66 bp
Genome contig ID gi89161190r_123862147
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTGCACTTTCCTTTCAATAAAGTTGTTGCATTCCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTGGTGTTTTTTTTTTTTTTTTTTTTAAGTTTATTTTGCATTAGACTG

Features of the protein sequence

Length: 1309 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93019 0 100.0 ubiquitin C var...
Homo sapiens
AAM50562 0 99.9 AT20865p [Droso...
Drosophila mela...
EDS39770 0 100.0 conserved hypot...
Culex quinquefa...
CAM39530 0 96.6 polyubiquitin, ...
Leishmania braz...
BAA23488 0 99.2 polyubiquitin [...
Cricetulus griseus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000626 27 47 PR00348 Ubiquitin
IPR000626 48 68 PR00348 Ubiquitin
IPR000626 69 90 PR00348 Ubiquitin
HMMPfam IPR000626 22 90 PF00240 Ubiquitin
IPR000626 98 166 PF00240 Ubiquitin
IPR000626 174 242 PF00240 Ubiquitin
IPR000626 250 318 PF00240 Ubiquitin
IPR000626 326 394 PF00240 Ubiquitin
IPR000626 402 470 PF00240 Ubiquitin
IPR000626 478 546 PF00240 Ubiquitin
IPR000626 554 622 PF00240 Ubiquitin
IPR000626 630 698 PF00240 Ubiquitin
IPR000626 706 774 PF00240 Ubiquitin
IPR000626 782 850 PF00240 Ubiquitin
IPR000626 858 926 PF00240 Ubiquitin
IPR000626 934 1002 PF00240 Ubiquitin
IPR000626 1010 1078 PF00240 Ubiquitin
IPR000626 1086 1154 PF00240 Ubiquitin
IPR000626 1162 1230 PF00240 Ubiquitin
IPR000626 1238 1306 PF00240 Ubiquitin
HMMSmart IPR000626 17 88 SM00213 Ubiquitin
IPR000626 93 164 SM00213 Ubiquitin
IPR000626 169 240 SM00213 Ubiquitin
IPR000626 245 316 SM00213 Ubiquitin
IPR000626 321 392 SM00213 Ubiquitin
IPR000626 397 468 SM00213 Ubiquitin
IPR000626 473 544 SM00213 Ubiquitin
IPR000626 549 620 SM00213 Ubiquitin
IPR000626 625 696 SM00213 Ubiquitin
IPR000626 701 772 SM00213 Ubiquitin
IPR000626 777 848 SM00213 Ubiquitin
IPR000626 853 924 SM00213 Ubiquitin
IPR000626 929 1000 SM00213 Ubiquitin
IPR000626 1005 1076 SM00213 Ubiquitin
IPR000626 1081 1152 SM00213 Ubiquitin
IPR000626 1157 1228 SM00213 Ubiquitin
IPR000626 1233 1304 SM00213 Ubiquitin
ProfileScan IPR000626 17 92 PS50053 Ubiquitin
IPR000626 93 168 PS50053 Ubiquitin
IPR000626 169 244 PS50053 Ubiquitin
IPR000626 245 320 PS50053 Ubiquitin
IPR000626 321 396 PS50053 Ubiquitin
IPR000626 397 472 PS50053 Ubiquitin
IPR000626 473 548 PS50053 Ubiquitin
IPR000626 549 624 PS50053 Ubiquitin
IPR000626 625 700 PS50053 Ubiquitin
IPR000626 701 776 PS50053 Ubiquitin
IPR000626 777 852 PS50053 Ubiquitin
IPR000626 853 928 PS50053 Ubiquitin
IPR000626 929 1004 PS50053 Ubiquitin
IPR000626 1005 1080 PS50053 Ubiquitin
IPR000626 1081 1156 PS50053 Ubiquitin
IPR000626 1157 1232 PS50053 Ubiquitin
IPR000626 1233 1308 PS50053 Ubiquitin
ScanRegExp IPR000626 43 68 PS00299 Ubiquitin
IPR000626 119 144 PS00299 Ubiquitin
IPR000626 195 220 PS00299 Ubiquitin
IPR000626 271 296 PS00299 Ubiquitin
IPR000626 347 372 PS00299 Ubiquitin
IPR000626 423 448 PS00299 Ubiquitin
IPR000626 499 524 PS00299 Ubiquitin
IPR000626 575 600 PS00299 Ubiquitin
IPR000626 651 676 PS00299 Ubiquitin
IPR000626 727 752 PS00299 Ubiquitin
IPR000626 803 828 PS00299 Ubiquitin
IPR000626 879 904 PS00299 Ubiquitin
IPR000626 955 980 PS00299 Ubiquitin
IPR000626 1031 1056 PS00299 Ubiquitin
IPR000626 1107 1132 PS00299 Ubiquitin
IPR000626 1183 1208 PS00299 Ubiquitin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp