ORK07307

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07307

Order Kazusa clone(s) from :

Accession No	AB208893
Product ID	ORK07307
Clone name	fk04248
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	USP1
cDNA sequence	DNA sequence (3504 bp) Predicted protein sequence (586 aa)
Description	Ubiquitin carboxyl-terminal hydrolase 1 (EC 3.1.2.15) (Ubiquitin thioesterase 1) (Ubiquitin-specific-processing protease 1) (Deubiquitinating enzyme 1) (hUBP).

Features of the cloned cDNA sequence

Description

Length: 3504 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	757 bp
Genome contig ID	gi89161185f_62575339
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TGGGAGGTCAATAAAATTTAAACTGCTTAACTATG
Flanking genome sequence (114660 - 114709)	----+--------+--------+--------+--------+----* TATATGAATATTTGAATTTTTTACTTGTATATTTTTATAAATACAGCTGA

Features of the protein sequence

Description

Length: 586 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92130	0	100.0	ubiquitin speci...	Homo sapiens
O94782	2.9e-214	98.4	Ubiquitin carbo...	Homo sapiens
BAG35333	2.9e-214	98.4	unnamed protein...	Homo sapiens
AAD11441	4.4e-214	98.2	ubiquitin-speci...	Homo sapiens
XP_513450	1.8e-213	97.8	ubiquitin speci...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	192	583	PF00443	Peptidase C19
ProfileScan	IPR001394	1	586	PS50235	Peptidase C19
ScanRegExp	IPR001394	377	395	PS00973	Peptidase C19

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp