Length: 7337 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
5827 bp |
Genome contig ID |
gi89161218f_23977650 |
PolyA signal sequence (CATAAA,-24) |
+----*----+----*----+----*----+---- TTTGCCTTTTTCATAAAAATCTTGGATTTGTTAAT |
Flanking genome sequence (166414 - 166463) |
----+----*----+----*----+----*----+----*----+----* ATATTGTTCCTGTTATTTTTGACATCTTTGCTATTGTAAATAAATTACTA |
Length: 436 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD93129 |
3.3e-175 |
100.0 |
X-linked zinc f...
|
Homo sapiens
|
XP_001090140 |
2e-168 |
98.3 |
zinc finger pro...
|
Macaca mulatta
|
P17010 |
2.3e-164 |
100.0 |
Zinc finger X-c...
|
Homo sapiens
|
AAM33386 |
3.3e-164 |
99.7 |
X-linked zinc f...
|
Homo sapiens
|
AAA61309 |
6.6e-164 |
99.7 |
zinc finger pro...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Search method |
interpro_ID |
From |
To |
Entry |
Definition |
HMMPfam |
IPR006794 |
73 |
414 |
PF04704 |
Zfx / Zfy transcription activation region |