Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07421
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209892
Product ID ORK07421
Clone name eg01353
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZFX
cDNA sequence DNA sequence (7337 bp)
Predicted protein sequence (436 aa)
Description Zinc finger X-chromosomal protein.
Features of the cloned cDNA sequence

Length: 7337 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 5827 bp
Genome contig ID gi89161218f_23977650
PolyA signal sequence
(CATAAA,-24)
+----*----+----*----+----*----+----
TTTGCCTTTTTCATAAAAATCTTGGATTTGTTAAT
Flanking genome sequence
(166414 - 166463)
----+----*----+----*----+----*----+----*----+----*
ATATTGTTCCTGTTATTTTTGACATCTTTGCTATTGTAAATAAATTACTA

Features of the protein sequence

Length: 436 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93129 3.3e-175 100.0 X-linked zinc f...
Homo sapiens
XP_001090140 2e-168 98.3 zinc finger pro...
Macaca mulatta
P17010 2.3e-164 100.0 Zinc finger X-c...
Homo sapiens
AAM33386 3.3e-164 99.7 X-linked zinc f...
Homo sapiens
AAA61309 6.6e-164 99.7 zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006794 73 414 PF04704 Zfx / Zfy transcription activation region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp