Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07423
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226142
Product ID ORK07423
Clone name pj01753
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZFYVE21
cDNA sequence DNA sequence (4464 bp)
Predicted protein sequence (255 aa)
Description Zinc finger FYVE domain-containing protein 21.
Features of the cloned cDNA sequence

Length: 4464 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 629 bp
Genome contig ID gi51511730f_103160599
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
ATATAAAGCTTATGATTAAAAACTATTTTGAACAT
Flanking genome sequence
(109156 - 109205)
----+----*----+----*----+----*----+----*----+----*
ACGGACAAGGCCTCGCCTTCCTGTGTCCAGATCACCTGAACCCTCGTGCC

Features of the protein sequence

Length: 255 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB71589 3.2e-72 99.4 unnamed protein...
Homo sapiens
XP_510190 4.9e-71 97.8 hypothetical pr...
Pan troglodytes
XP_001088673 1.5e-69 95.6 similar to zinc...
Macaca mulatta
XP_537565 1.1e-59 83.6 similar to zinc...
Canis lupus fam...
EDL18609 1.3e-56 79.4 zinc finger, FY...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR000306 8 103 SM00064 Zinc finger
ProfileScan IPR000306 47 97 PS50178 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp