Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07443
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226052
Product ID ORK07443
Clone name fk05484
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RNF112
cDNA sequence DNA sequence (3166 bp)
Predicted protein sequence (649 aa)
Description Zinc finger protein 179 (Brain finger protein) (RING finger protein 112).
Features of the cloned cDNA sequence

Length: 3166 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1099 bp
Genome contig ID gi51511734f_19155144
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CCTTTATTTTATGAAAAATAAAATGTGTGTATGTG
Flanking genome sequence
(106037 - 106086)
----+----*----+----*----+----*----+----*----+----*
AATGTCAGCTTCCCAGTATATTATTGAAACAGAATTTAACCCTCAGATGA

Features of the protein sequence

Length: 649 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH53989 0 100.0 Ring finger pro...
Homo sapiens
XP_511334 0 99.8 zinc finger pro...
Pan troglodytes
Q9ULX5 0 99.8 RING finger pro...
Homo sapiens
XP_001100292 0 98.0 similar to zinc...
Macaca mulatta
EAW50891 4.6e-215 100.0 zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001841 75 115 PF00097 Zinc finger
IPR015894 163 312 PF02263 Guanylate-binding protein
HMMSmart IPR001841 75 115 SM00184 Zinc finger
ProfileScan IPR001841 75 116 PS50089 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp