Length: 3950 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
0 bp |
Genome contig ID |
gi42406306f_39762967 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- TCCTAATTCCACTGTAGAAGCTTTTTTCAAGAAGT |
Flanking genome sequence (103951 - 104000) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG |
Length: 101 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92463 |
1.4e-46 |
100.0 |
similar to regu...
|
Homo sapiens
|
BAG59944 |
3.6e-23 |
100.0 |
unnamed protein...
|
Homo sapiens
|
Q9NR11 |
3.4e-21 |
100.0 |
Zinc finger pro...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.