Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07456
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209226
Product ID ORK07456
Clone name fj13119
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF302
cDNA sequence DNA sequence (3950 bp)
Predicted protein sequence (101 aa)
Description Zinc finger protein 302 (ZNF135-like) (ZNF140-like).
Features of the cloned cDNA sequence

Length: 3950 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi42406306f_39762967
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCCTAATTCCACTGTAGAAGCTTTTTTCAAGAAGT
Flanking genome sequence
(103951 - 104000)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG

Features of the protein sequence

Length: 101 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92463 1.4e-46 100.0 similar to regu...
Homo sapiens
BAG59944 3.6e-23 100.0 unnamed protein...
Homo sapiens
Q9NR11 3.4e-21 100.0 Zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp