ORK07542

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07542

Order Kazusa clone(s) from :

Accession No	AB209479
Product ID	ORK07542
Clone name	ah06279
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	VARS2
cDNA sequence	DNA sequence (6051 bp) Predicted protein sequence (819 aa)
Description	Homo sapiens premature mRNA for VARS2L protein variant.

Features of the cloned cDNA sequence

Description

Length: 6051 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	246 bp
Genome contig ID	gi89161210f_30883998
PolyA signal sequence (GATAAA,-19)	+--------+--------+----*----+---- GGAATGAGGAGATTGAGATAAACTTTTGAAATCCC
Flanking genome sequence (118216 - 118265)	----+--------+--------+--------+--------+----* AAACATGTCTGTTTATGGCTCTTTGGTCCCCTTTGCTCCCAGTGGTGACT

Features of the protein sequence

Description

Length: 819 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92716	100.0	VARS2L protein ...	Homo sapiens
CAI18453	100.0	valyl-tRNA synt...	Homo sapiens
EAX03348	99.7	valyl-tRNA synt...	Homo sapiens
AAI12055	99.6	Valyl-tRNA synt...	Homo sapiens
CAI18004	99.6	valyl-tRNA synt...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002303	107	124	PR00986	Valyl-tRNA synthetase
	IPR002303	223	236	PR00986	Valyl-tRNA synthetase
	IPR002303	335	356	PR00986	Valyl-tRNA synthetase
	IPR002303	366	384	PR00986	Valyl-tRNA synthetase
HMMPfam	IPR002300	12	491	PF00133	Aminoacyl-tRNA synthetase
HMMPfam	IPR013155	535	688	PF08264	Valyl/Leucyl/Isoleucyl-tRNA synthetase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	VFCALVPGSSVAVTEAFVRLYKA	23	PRIMARY	23