Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07554
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226174
Product ID ORK07554
Clone name bm04451
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ST6GALNAC6
cDNA sequence DNA sequence (2281 bp)
Predicted protein sequence (333 aa)
Description ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Features of the cloned cDNA sequence

Length: 2281 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1278 bp
Genome contig ID gi89161216r_129587421
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TGATTTGTACAGGAATAAACACACCTACGCTCCGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTTCGTGTCCTGTGTCACCTGGGTCGAGCACAGCCTTCTGGTCCAGCGCT

Features of the protein sequence

Length: 333 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q969X2 1.6e-143 99.0 Alpha-N-acetylg...
Homo sapiens
EAW87710 1.8e-143 99.0 ST6 (alpha-N-ac...
Homo sapiens
XP_001094460 7.9e-142 97.8 similar to ST6 ...
Macaca mulatta
XP_850906 1.6e-139 95.7 similar to ST6 ...
Canis lupus fam...
Q9JM95 2.4e-135 92.0 Alpha-N-acetylg...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001675 32 319 PF00777 Glycosyl transferase

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 44 AVFVILFALITILILYSSNSANE 66 PRIMARY 23
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp