ORK07554

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07554

Order Kazusa clone(s) from :

Accession No	AK226174
Product ID	ORK07554
Clone name	bm04451
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ST6GALNAC6
cDNA sequence	DNA sequence (2281 bp) Predicted protein sequence (333 aa)
Description	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6

Features of the cloned cDNA sequence

Description

Length: 2281 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1278 bp
Genome contig ID	gi89161216r_129587421
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TGATTTGTACAGGAATAAACACACCTACGCTCCGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTCGTGTCCTGTGTCACCTGGGTCGAGCACAGCCTTCTGGTCCAGCGCT

Features of the protein sequence

Description

Length: 333 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q969X2	1.6e-143	99.0	Alpha-N-acetylg...	Homo sapiens
EAW87710	1.8e-143	99.0	ST6 (alpha-N-ac...	Homo sapiens
XP_001094460	7.9e-142	97.8	similar to ST6 ...	Macaca mulatta
XP_850906	1.6e-139	95.7	similar to ST6 ...	Canis lupus fam...
Q9JM95	2.4e-135	92.0	Alpha-N-acetylg...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001675	32	319	PF00777	Glycosyl transferase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	44	AVFVILFALITILILYSSNSANE	66	PRIMARY	23