Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07555
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209818
Product ID ORK07555
Clone name bm04566
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol HSPA1A
cDNA sequence DNA sequence (2388 bp)
Predicted protein sequence (709 aa)
Flexi ORF Clone FXC07555
Description Homo sapiens mRNA for heat shock 70kDa protein 1A variant protein.
Features of the cloned cDNA sequence

Length: 2388 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 258 bp
Genome contig ID gi89161210f_31791309
PolyA signal sequence
(AATAAA,-17)		 
+----*----+----*----+----*----+----
GTTGGTTACTTCAAAGTAAATAAACTTTAAAATTC
Flanking genome sequence
(102389 - 102438)		 
----+----*----+----*----+----*----+----*----+----*
AAGTGATGCCTTTTATTCCTTTATTTGGGGGTCAGTAGGGTCTGCATAGG

Features of the protein sequence

Length: 709 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93055 0 100.0 heat shock 70kD...
 Homo sapiens
AAD21816 0 99.8 HSP70-1 [Homo s...
 Homo sapiens
Q5R7D3 0 99.6 Heat shock 70 k...
 Pongo abelii
AAX43782 0 99.6 heat shock 70kD...
 synthetic construct
AAD21815 0 99.5 HSP70-2 [Homo s...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR013126 142 234 PD000089 Heat shock protein 70
FPrintScan IPR001023 73 86 PR00301 Heat shock protein Hsp70
IPR001023 101 113 PR00301 Heat shock protein Hsp70
IPR001023 123 131 PR00301 Heat shock protein Hsp70
IPR001023 210 230 PR00301 Heat shock protein Hsp70
IPR001023 271 281 PR00301 Heat shock protein Hsp70
IPR001023 399 415 PR00301 Heat shock protein Hsp70
IPR001023 431 451 PR00301 Heat shock protein Hsp70
IPR001023 458 477 PR00301 Heat shock protein Hsp70
IPR001023 539 555 PR00301 Heat shock protein Hsp70
HMMPfam IPR013126 74 680 PF00012 Heat shock protein 70
ScanRegExp IPR013126 77 84 PS00297 Heat shock protein 70
IPR013126 265 278 PS00329 Heat shock protein 70
IPR013126 402 416 PS01036 Heat shock protein 70
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp