Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07556
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209825
Product ID ORK07556
Clone name bm04905
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CCND3
cDNA sequence DNA sequence (1853 bp)
Predicted protein sequence (288 aa)
Description Homo sapiens mRNA for cyclin D3 variant protein.
Features of the cloned cDNA sequence

Length: 1853 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 984 bp
Genome contig ID gi89161210r_41910672
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CCATCATCCTACTGTAATAAAGATGATTGTGAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAACTGGCTTTGGCTTCTTGGATTGGTGTGTGGGTAAGTCTATTTCTGC

Features of the protein sequence

Length: 288 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93062 2.1e-115 100.0 cyclin D3 varia...
Homo sapiens
EAX04076 7.5e-87 97.0 cyclin D3, isof...
Homo sapiens
CAI23490 1.3e-86 96.6 cyclin D3 [Homo...
Homo sapiens
BAG51531 1.5e-86 96.6 unnamed protein...
Homo sapiens
XP_001086274 2.8e-86 96.6 cyclin D3 isofo...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006671 62 149 PF00134 Cyclin
IPR004367 151 280 PF02984 Cyclin
HMMSmart IPR006670 62 142 SM00385 Cyclin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp