Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07560
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209842
Product ID ORK07560
Clone name ef00702
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TGFB2
cDNA sequence DNA sequence (8420 bp)
Predicted protein sequence (267 aa)
Description Homo sapiens mRNA for transforming growth factor, beta 2 variant protein.
Features of the cloned cDNA sequence

Length: 8420 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 6323 bp
Genome contig ID gi89161185f_216485423
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGCGACAGAGCCAAATTCAGTCTC
Flanking genome sequence
(166408 - 166457)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAATAGCAGGCCCAGAAATGACACAGCATCACTTT

Features of the protein sequence

Length: 267 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93079 6.5e-116 100.0 transforming gr...
Homo sapiens
AAA50404 5.3e-81 99.0 transforming gr...
Homo sapiens
XP_001489417 1.8e-80 98.0 similar to tran...
Equus caballus
XP_545713 2.2e-80 98.0 similar to tran...
Canis lupus fam...
AAR06973 3.7e-78 96.0 transforming gr...
Oryctolagus cun...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR003940 3 24 PR01425 Transforming growth factor
IPR003911 9 28 PR01423 Transforming growth factor beta TGFb
IPR003940 51 70 PR01425 Transforming growth factor
IPR003911 63 75 PR01423 Transforming growth factor beta TGFb
IPR003940 77 99 PR01425 Transforming growth factor
IPR003940 145 160 PR01425 Transforming growth factor
IPR003940 181 192 PR01425 Transforming growth factor
IPR003911 190 204 PR01423 Transforming growth factor beta TGFb
HMMPfam IPR001111 25 266 PF00688 Transforming growth factor beta (TGFb)

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 5 CVLSAFLILHLVTVALSLSTCST 27 PRIMARY 23
2 195 IELYQVMFICCCCCCCCCCFRQT 217 PRIMARY 23
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp