Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07564
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209904
Product ID ORK07564
Clone name eh00712
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol GNPDA2
cDNA sequence DNA sequence (5383 bp)
Predicted protein sequence (294 aa)
Description glucosamine-6-phosphate deaminase 2
Features of the cloned cDNA sequence

Length: 5383 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4496 bp
Genome contig ID gi89161207r_44300020
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
TTTTCAATAAACTTGACTATATCAAGATGGGAACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACAGGCTTACTGTGTCTTATAAAAAATACTTTGTTGTCTAAAGTAAAT

Features of the protein sequence

Length: 294 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93141 6.2e-132 100.0 glucosamine-6-p...
Homo sapiens
XP_001143245 1e-130 100.0 similar to gluc...
Pan troglodytes
Q8TDQ7 2.6e-113 100.0 Glucosamine-6-p...
Homo sapiens
XP_858777 7.6e-113 98.8 similar to gluc...
Canis lupus fam...
BAB70977 1.1e-112 99.6 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006148 50 285 PF01182 Glucosamine/galactosamine-6-phosphate isomerase
HMMTigr IPR004547 36 293 TIGR00502 Glucosamine-6-phosphate isomerase
ScanRegExp IPR004547 160 178 PS01161 Glucosamine-6-phosphate isomerase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp