Length: 4578 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
4276 bp |
Genome contig ID |
gi89161216r_33884479 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- GAACTGAAGAGCCTAACTGCCCTCTTTGTTTAGGG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAGAAAAAATCTTTGGGAATAAACAAAATAACCCAAAT |
Length: 99 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD93148 |
1e-39 |
100.0 |
ubiquitin assoc...
|
Homo sapiens
|
CAM13516 |
1.9e-19 |
96.6 |
ubiquitin assoc...
|
Homo sapiens
|
AAF67493 |
2.5e-19 |
96.6 |
AD-012 protein ...
|
Homo sapiens
|
Q5T6F2 |
4.2e-19 |
96.6 |
Ubiquitin-assoc...
|
Homo sapiens
|
XP_528586 |
1.2e-18 |
95.0 |
ubiquitin assoc...
|
Pan troglodytes
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
15 |
SDFLFCTYIILYILYMMTSVSSD |
37 |
PRIMARY |
23 |